dctS [2020-04-09 15:33:54]

two-component sensor kinase, regulation of the dctS-dctR-dctP operon

Locus: BSU_04450

Isoelectric point: 6.20

Molecular weight: 59.77 kDa

Protein length: 535 aa

Gene length: 1608 bp

Function: regulation of the dctS-dctR-dctP operon

Product: two-component sensor kinase

Essential: no

Synonyms: ydbF

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of organic acids
• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of two-component response regulators → Two-component sensor kinase
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 497,768 499,375

The protein

Catalyzed reaction/ biological activity

• autophosphorylation, phosphorylation of DctR
• ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

Domains

• two transmembrane segments
• PAS domain (aa 213–276) (according to UniProt)
• Histidine kinase domain (aa 333-528) (according to UniProt)

Modification

• autophosphorylation on a His residue

Effectors of protein activity

• DctB and DctP act as co-sensors with DctS PubMed

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: dctS-dctR-dctP
  Description: PubMed

  Regulation

  • part of the iron sparing response, strong down-regulation in a fur mutant (Fur, FsrA) PubMed

Biological materials

Mutant

• GP225 (dctS::cat), available in Jörg Stülke's lab
• BKE04450 (dctS::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCAGCTTCTCCTTTCAGG, downstream forward: _UP4_CCAATGAAGGGGGAGGAAGC
• BKK04450 (dctS::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCAGCTTCTCCTTTCAGG, downstream forward: _UP4_CCAATGAAGGGGGAGGAAGC

References

Loading